rainbowandunicornsbe rainbowandunicornsbe
  • 21-08-2022
  • Mathematics
contestada

The following figure is made of 1 triangle and 1
rectangle.
A
9
B
5
6
Find the area of each part of the figure and
the whole figure.

The following figure is made of 1 triangle and 1 rectangle A 9 B 5 6 Find the area of each part of the figure and the whole figure class=

Respuesta :

Otras preguntas

find the linearization of the function f(x,y)=131−4x2−3y2‾‾‾‾‾‾‾‾‾‾‾‾‾‾‾√ at the point (5, 3). l(x,y)= use the linear approximation to estimate the value of f(4
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
Find the area of the parallelogram in the coordinate plane. A (7,5) D(-9,-2) Units B(6,5) C(4-2)
Question 6 Photochemical smog is caused when nitrogen and carbon react in sunlight. Which describes a way humans can decrease the amount of photochemical smog?
consider the integral ∫10 4(4x2 4x 5)dx (a) find the riemann sum for this integral using right endpoints and n=3. (b) find the riemann sum for this same integra
D. Use a circular doubly linked chain to implement the ADT deque.
Quiz dentify the benefits and drawbacks first generation language​
please write a 5-paragraph rough draft about why Bernice should keep the piano in the film "piano lesion" please write it for me
Which of the following is a problem that results from excess nitrogen in coastal waterways? A Excess production of carbon dioxide B. Harmful algal blooms (HABS)
50 Points! Multiple choice geometry question. Photo attached. Thank you!