caromgg425 caromgg425

21-09-2022
Mathematics

contestada

the law of cosines is a^2 + b^2 -2 abcosC - c^2 Find the value of 2abcos C

Respuesta :

Otras preguntas

I will mark brainliest whoever has a good answer. Type one interesting/new thing you learned from a classmate.

How many hydrogen atoms can be attached to carbon a?.

The sum of the first twenty-one terms of an arithmetic series is 273. The fifth term is 7. What is the 49th term?

I NEED ANSWER BEFORE JANUARY 30TH PLEASE Describe what would happen if the chromosomes did not attach to spindle fibers during metaphase I.

Please help I will mark brainliest!! Match the given slope (m) and y-intercept (b) with the equation of the line in slope-Intercept form. Slope, m = 2. y-interc

A hurricane destroys the bayou where sawgrass grows, which many insects eat. What would happen to the carrying capacity and why?

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

The local newspaper has letters to the editor from 80 people. If this number represents the newspaper's readers, how many readers does the newspaper have? The n

Laura deposits 2000 into an account that pays simple interest at a rate of 4% per year. How much interest will she be paid in the first 4 years?

I would have enjoyed with Tom, if I -----(have) enough time.