cerdac45stu cerdac45stu

21-05-2023
Mathematics

contestada

An international company has 23800 employees in one country. If this represents 23.1% of the company's employees, how many employees does it have in total?

Respuesta :

Otras preguntas

I need help with this question ???

Can somebody please help me?

Answer choices:Label A: endoplasmic reticulum, chloroplast, or cell membraneLabel B: Golgi apparatus, nucleus, or vacuole.Label C: cytoplasm, vacuole or cell wa

Which characteristics describe bitewing images? Select all that apply.

What is the measure of the unknown angle?

How are alleles represented in genetics?

What are the 2 main components of the Central Nervous System?

The price of a holiday was decreased by 12 percent to 600 . What was the price before the decrease?

Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands

ano ang ibig sabihin ng konsepto