valerie2027posada valerie2027posada
  • 24-04-2024
  • Biology
contestada

Codons
Which amino acids does this mRNA strand code for?
*You must spell out the entire name of the amino acid*

5'CCGGAUGUCCGUAUAACGGC3'

Respuesta :

Otras preguntas

What is the maximum number of single covalent bonds a carbon atom can form with other elements?.
Where are phospholipids most likely found in a eukaryotic cell?.
Details are a very unimportant part of reading. TrueFalse
unit 7 right triangles & trigonometry homework 2 special right triangles pls help with 16,18 and 20
how mnay people are on this earth
An aquarium can be modeled as a right rectangular prism. Its dimensions are 14 in by 10 in by 8 in. How many cubic inches of water are in it when it is full? Ro
find the slope for the ones that are circled
MATCH EACH PLease quick
How many terms are in the expression? 4x+3y+7z+5 ​
the is a very important part of the treatment -