sandra1343 sandra1343
  • 21-09-2018
  • Mathematics
contestada

Write the word name for each decimal.
1. 5. 12
2. 94.003

Respuesta :

alana04 alana04
  • 21-09-2018
what does number one say?
Answer Link

Otras preguntas

11) am = n + p, for a
Part of mirrens role as opperations manager is to make sure the company isn’t wasting energy or creating excessive pollution in there operations
you have 5 shelves. you put 5 books on each self. there are 4 books left. how many books did you have to start
A boy leaves his home at 5:00 pm, drives around the city a distance of 24 miles, and returns home at 5:30 pm. His average velocity is???
help me please show your solution ​
Why is it important to use both primary and secondary sources when constructing historical arguments?
The blank of this cube is 216 cubic inches.
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
punctuate thisMy father was born in Honolulu Hawaii U.S.A.​
The length of a rectangle is 7yd more than twice the width x. The area is 372^2