brokenillusion brokenillusion

25-10-2018
Mathematics

contestada

why is the absolute value of -235 greater than the absolute value of 220

Respuesta :

snowdroploving snowdroploving

25-10-2018

To find the absolute value of a negative number, you can simply remove the negative. ., -235 turns into 235, and 235 is greater than 220.

Answer Link

lexilope20066 lexilope20066

25-10-2018

The -235 turns into 235 because of the absolute value. 235 is greater than 220

Answer Link

Otras preguntas

an object is launched upward from ground level and reaches a maximum height of h feet. The initial velocity v (in feet per seconds) of the object is given by th

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both

A biological membrane is selectively permeable in that it can, to some extent,control which substances pass through it. Based ont he information provided in Boo

A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you

Meaning of highland cow

The tube that connects the bladder and the outside is called the

I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2

What is the second Vatican council?

ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,