nai97 nai97
  • 24-06-2019
  • Mathematics
contestada

find the value of 5x-6 given that 2x-7=9​

Respuesta :

jimrgrant1 jimrgrant1
  • 24-06-2019

Answer:

34

Step-by-step explanation:

Given that

2x - 7 = 9 ← solve for x

Add 7 to both sides

2x = 16 ( divide both sides by 2 )

x = 8

Substitute x = 8 into 5x - 6

5x - 6 = (5 × 8) - 6 = 40 - 6 = 34

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
¿ Tiene Ud. hermanos? Sí, tengo _____ una hermana.
a recipe for a cake needs 3/4 of a cup of milk. You are making 1/2 of the recipe. How much milk do you need?
Julie budgets $3000 a month to spend on living expenses for her family. If she spends $600 on food each month, what fraction of her budget is spent on food?
What is the missing term, x, in the pattern? –2, x, –50, 250, –1250
The law or act that protects against invasive acts by private individuals using electronic devices is _____.
true or false Rise is the vertical change between any two points on a line
Jordon has taken a job that is extremely dangerous, but that pays him enough so that he is sure he will have enough to eat and he will be able to sleep in a war
Michael stopped using performance enhancing drugs at the end of his high school athletic career. Which long term effects might he experience as he grows older?
Many people with schizophrenia develop ___________, ideas that they believe wholeheartedly but that have no basis in fact.