ImaBtired
ImaBtired ImaBtired
  • 23-10-2019
  • Mathematics
contestada

What is 78902 times 6743 divided by 567.

Respuesta :

maxlyman05 maxlyman05
  • 23-10-2019

Answer:

938335.425044

Step-by-step explanation:

Answer Link
Аноним Аноним
  • 23-10-2019

Answer:

938,347.3

Step-by-step explanation:

78,903 x 6,743 = 532,042,929‬

532,042,929 ÷ 567 = 938,347.3174603175‬

938,347.3174603175 can be rounded to the nearest tenth. This results in 938,347.3.

Answer Link

Otras preguntas

WILL GIVE BRAINLIEST
A measure of the average value of a random variable is called.
What is the equation of the line that is perpendicular to line m and passes through the point (3, 2)?
if a big person and a small person run up the stairs at the same time who has more force
Summary abt romeo and juliet act 1
hey guys , can you help me with this question please … i seriously don’t wanna fail this
A copy machine makes 32 copies per minute. How long does it take to make 144 copies? ?????
Aurelia is designing a user interface for a new game app. Which of the following should she taken into consideration for the user interface? A. how many variab
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Cellular respiration is an examole of. A. Catabolic pathway Anabolic pathway . Extracellular activity D. Thermodynamics