annette36 annette36

21-11-2019
Mathematics

contestada

8
Write and solve a number sentence that is
modeled below:

Respuesta :

jaylyncarrillo29 jaylyncarrillo29

21-11-2019

Answer:

there is 16 pieces on thanksgiving, on chrisimas thiere 8 pieces of ate. how pieces did they both ate

Step-by-step explanation:

Answer Link

Otras preguntas

Match each bolded word in this excerpt from Arthur Conan Doyle's "The Contest" with a word that is closest in meaning. In the year of our Lord 66, the Emperor

When earth completes a full rotation how many times has elapsed? (A) 1 day (B) 1 week (C) 1 month (D) 1 year

Two angles have a common vertex but no common side. How can you tell whether the angles are vertical angles. Please answer

Multicellular plants and animals have organs with specific functions. Which structures do eukaryotic cells have for performing specific functions? A. ri

In similar but not congruent polygons, corresponding sides are A. sometimes congruent B. similar C. congruent D. proportional

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

PLS HELP ME ASAP Which situation can be simulated by rolling a six-sided die once? A.selecting one person from a group of four boys and two girls B.picking one

simply 10(15 + n) answer

In 1722, william caslon designed caslon old style and its italic version. ________________ introduced the typeface caslon into the american colonies, where it w

is 9 feet greater than less than or equal to 4 yards