ZanoviaDurant ZanoviaDurant

23-03-2020
Mathematics

contestada

In Evan's white gold wedding ring, the ratio of nickel to gold is 3 to 13. If the ring contains 4.16 oz of gold, how much nickel does it contain?

Respuesta :

Аноним Аноним

23-03-2020

Answer:

.96

Step-by-step explanation:

Answer Link

Otras preguntas

what happened when citric acid and and bicarbonate soda mixed together

A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut

what is the most widely held ideal of the us political culture

If a DNA template strand has a sequence of 3' TACAATGTAGCC 5', then the RNA produced from it will be which sequence? A.) 3' AUGUUACAUCGG 5'. B.) 3' TACAATGTAGCC

A patient received a new heart transplant, but shows signs of graft rejection after 2 weeks. Which type of hypersensitivity reaction is in progress?" a) Type I

Do any of these represent a linear function (just state letters if they do)

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

When is cash pulled out of circulation

7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da

Which process must occur before collection? A:precipitation B:condensation C:evaporation D:none of the above