neoanderson13 neoanderson13

25-03-2020
History

contestada

please help me asap
question 4: in first screenshot
question 5: in second screenshot

please help me asap question 4 in first screenshot question 5 in second screenshot class=

please help me asap question 4 in first screenshot question 5 in second screenshot class=

Respuesta :

Dahrexycouture Dahrexycouture

25-03-2020

Answer:

B

Explanation:

During the war, immigration from Europe reached all-time highs

Answer Link

Otras preguntas

Distinguish between eukaryotic and prokaryotic binary fission.

what is 7/8ths of 40

Emily buys 4pens for £1 how much would 7 pens cost ?

if if x+y=10, find the value of y when x=3

write a sentence with the word labyrinth

Piaget believed that language helped foster cognitive development. Please select the best answer from the choices provided True or False

Find the smallest zero for the function h(x) = 4x^2 - 8x - 60

. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to

a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC