fgscarboroguh760 fgscarboroguh760
  • 26-03-2020
  • Mathematics
contestada

2pq - 5qr + 10r - 4p

Respuesta :

profile808 profile808
  • 26-03-2020
I’m going to guess here that your wanting to factor this equation. The answer for that would be (2p-5r)(q-2). I hope this helps.
Answer Link

Otras preguntas

If the vertical deflection of the electron as it leaves the plates is 9.00 mm, how much has its kinetic energy increased due to the electric field?
how many bases are in a anticodon
Consider a simple parallel-plate capacitor whose plates are given equal and opposite charges and are separated by a distance d. Suppose the plates are pulled ap
4. At what point does the trip change from an ordeal to a pleasant adventure? What key discovery causes the chance
2 The process of studying your subject from many angles is called A analytical looping B narrowing C cubing D gathering details
Select from the given unit rates to match with each quantity
Recall that a prtiticilple is in verb form that is used as an adjective. A participial phrase is a participle with its modifiers and complements used an an adje
Suppose the price of barley increases by 16.53%. If breweries buy 3.28% less barley after the price increase, the total revenue for barley producers will _____
Selim is a sales manager for the Bratney Companies, a company that manufactures equipment used in the processing of grains and other produce. Every year, Selim
If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc​