luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

Julius Caesar, hero or tyrant?! And why????
sue stacked one box onto another. the bottom had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. how tall were the stacked boxes?
Write the equation For a Line that intersects points(1,3) And (2,5) which one is a.y=x+2 B.y=2x+1. C.y=3x-3. D.Y=-x+3 For me is letter B.please help
Homophones ~~~ a) a female sheep / an evergreen tree b) sandy shore / kind of tree c) guided / a metal d) opens lock / harbour e) flat land / joiner's tool f)
what is the possessive case?
the one to one functions G and H are defined as followG={(-8,1),(1,5),(4,-5)(8,-9)}H(x)=3x+4find the following g^-1(1)=h^-1(x)=(h^-1oh)(-2)=
What expression represents the number of squares in terms of the figure number?
Write the equation For a Line that intersects points(1,3) And (2,5) which one is a.y=x+2 B.y=2x+1. C.y=3x-3. D.Y=-x+3 For me is letter B.please help
Find the domain of each rational expression. f(x)=5x-7/4
Calculate the slope of a Line that intersects point (6,2) And ((-4,-3). A.1/2. B.2/3 C.4/5. D.7/8. For me the answer are a. Please help me.