helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Gerhan Company's flexible budget for the units manufactured in May shows $15,420 of total factory overhead; this output level represents 70% of available capaci
Which gland seceretes thyroid stimulating horomones.?
Consider these properties: reflexive, symmetric, transitive. Which properties are held by the composition of relations o? If your answer is yes for a property,
calculate the time required for an astronaut to free fall 50 m on the moon\
How do you stretch serratus anterior?
ancient communication methods
A cyclist accelerates from rest along a straight, horizontal path for a time taccel=19.5s at a rate of a=1.5m/s²
What is the SI unit to newton?
Which of the following is not a forensic file image format? A. dd. B. E01 C. SMART D. UPS. E. UPS.
Compare what Child and Slaughter think about suspense. Based on their ideas and your own ideas about suspense, explain what you think is the most effective way