edpamperin57 edpamperin57
  • 23-06-2020
  • Mathematics
contestada

What is the x-intercept and the y-intercept of the graph of 6x - 3y = 18? Show your work.

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 23-06-2020

Answer:

see below

Step-by-step explanation:

To find the x intercept set y = 0 and solve for x

6x - 3y = 18

6x - 0 = 18

6x = 18

Divide by 6

6x/6 = 18/6

x = 3

(3,0)

To find the y intercept set x = 0 and solve for y

6x - 3y = 18

0 - 3y = 18

-3y = 18

Divide by -3

-3y/-3 = 18/-3

y = -6

(0,-6)

Answer Link

Otras preguntas

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Read the excerpt from Roll of Thunder, Hear My Cry. “Ah, man, leave me be! All y'all Logans think y'all so doggone much with y'all's new coats and books and shi
There is a large concentration of which of these inside muscles? A. protein B. enzyme C. peptides
Is this correct, if so please explain why?
During a sale, a dress is marked down from a selling price of $60 to a sale price of $48. What is the percent markdown? Help
glycerol is called or negative catalyst .give reason.​
How many quadrilaterals are in this triangle?
Savannah had 400400400 chocolate chips. She saved xxx chips for a garnish, and mixed the rest of the chocolate chips evenly into 333 pans of brownies. How many
Help me with a question?
Brinkmanship was a bold, aggressive idea because it required