TrashKing35 TrashKing35

23-07-2020
History

contestada

Which of the following best describes the abolition of slavery in haiti?

Respuesta :

nyyazlyyewmubammet nyyazlyyewmubammet

23-07-2020

Answer: There is no detail.

Explanation:

Answer Link

Otras preguntas

4200 in the scientific notation.

The French allow adolescents to drink at age 16. In America, the drinking age is 21. Eric wants to explore the reasoning behind this. He wonders what factors an

please help me on this

PLEASE HELP! A park charges $16 for one round of miniature golf and a reduced fee for each additional round played. If Tom paid $51 for 6 rounds of miniature go

What is used to remove prophy paste from between the teeth after a coronal polish?

Help me plzzzzz Speaking in 2 min Describe something you can do to help protect the environment

What are two ways that the legislative branch checks the executive branch in the selection of judicial appointees? The Senate Judiciary interviews judicial appo

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

A geometric progression is a sequence of numbers in which each value.

What is an example of an assumption and dependency that an automated stocking application project would include in an SRS? A. The software will be used by well