montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

A study was conducted to determine the relationship between the outdoor temperature and the number of visitors to a municipal swimming pool. What are the indep

eugene wants to buy jeans at a store that is giving $10 off everything. the tav on the jeans is marked 50% off. the original price is $49.98. find the total cos

A word that modifies a verb; answering the questions how, when, where and how much is commonly referred to as a. a. Pronoun c. Verb b. Adjective d. Adverb

Why would people likely go to a small doctors office

Ray Cupple bought a basic car costing $10,150.00, with options costing $738.00. There is a 6% sales tax in his state and a combined $50.00 license and registrat

12 is what percent of 30?

The word likewise is used as a signal for _____. a. comparing b. contrasting

Rectangles ABCD and EFGH have the same shape. What is the length oh FG

Elizabeth has 87.75 feet of banner paper how many banners can she make that are 11.25 feet long?

A main event of President Johnson's administration was: the failed Bay of Pigs invasion conflict with Russia over missiles in Cuba active U.S. involvement in Vi