kristinamyakka kristinamyakka

23-09-2020
Mathematics

contestada

Last year Betty's annual salary was $42000. This year she received a raise and now eams $46500. On a weekly basis, how much more does Betty earn?

Respuesta :

tatumtalley19 tatumtalley19

23-09-2020

Answer:

About 87$

Step-by-step explanation:

Yu take both salary amounts an divide by 52 since there are 52 weeks in a year and then find the difference between them

Answer Link

Otras preguntas

what continenf is at 60 south and 60 east

Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?

A patient comes into the clinic with a resting heart rate of 80 beats per minute (bpm). The patient's cardiac output was found to be 5.6 liters/minute with an e

what is the most widely held ideal of the us political culture

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more

The heart sounds S1 and S2 are...?

In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre

Sharp pain is transmitted through which type of nerve fibers?

Compare and contrast immune tolerance with licensing