jayde62 jayde62
  • 23-09-2020
  • Mathematics
contestada

Which number gives you a rational sum when you add it to 4/7?

Respuesta :

apikunwar20
apikunwar20 apikunwar20
  • 23-09-2020

Answer:

Thus, the rational number 93/77 should be added to -7/11 so as to get 4/7.

Answer Link

Otras preguntas

Guys <br /> I want the word resolute and naturalization in a sentence separate
Factor polynomial: 5x^2+21x+4=0
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what finger does the ring go on
Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?
What name was given to the Allied plan to invade France?
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated