austinjackson38 austinjackson38
  • 25-09-2020
  • History
contestada


A former actress, Theodora was the wife of Byzantine Emperor Justinian. She
assisted him in all of the following areas EXCEPT:

Respuesta :

leury1217
leury1217 leury1217
  • 25-09-2020

Answer:

Empress Theodora (c. 497–June 28, 548), wife of Emperor Justinian I, is regarded as the most powerful woman in Byzantine history. Because of her intelligence and political savvy, she was Justinian's most trusted adviser and used her influence to promote religious and social policies in line with her interests.

Explanation:

..

Answer Link

Otras preguntas

How are glial cells and neurons alike and how are they different. Give 3 sentences for each
If y= 4x +5 has a gradient of 4 write the equation of a line parrellel to it?
How can one concentrate in studies ?
Can somebody please explain to me how the acceleration in simple hormonic motion is proportional to the displacement..
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what number should be added to the expression to turn it into a perfect square trinomial x^2+2x
what is the property of 6x=72
Find the smallest zero for the function h(x) = 4x^2 - 8x - 60
0-4+7-5×3÷9×5-4 do the sum of that mathematics...
why does a virus stay in a person for life, such as hepatitis