deniz123345 deniz123345
  • 24-12-2020
  • English
contestada

can you help me please

can you help me please class=

Respuesta :

sophia2560
sophia2560 sophia2560
  • 24-12-2020

Q2

1 draw a picture

2 speak a foreign language

3 play chess

4 act in a show

5 cook dinner

6 sing into a microphone

Q3

1 solve

2 smart

3 perfect

4 strong

5 speak

6 difficult

Answer Link

Otras preguntas

the primary organic source of energy for living things are
Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this
How many cm has a inch
A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ
5. udents are asked to compare the layers of the Earth to the layers of the Sun and draw a model of each Earth's Layers mantle outer core inner core Sun's Layer
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
Can anyone to correct it if necessary?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Rulers of the Zhou dynasty established the Mandate of Heaven to ________.
Which scientific advancement is linked to the Muslim scholar Al- Khwarizmi? O A. He discovered new species of life on the ocean floor. B. He developed a unified