Seudónimo Seudónimo

25-10-2016
Mathematics

contestada

Write 2 multiplication problems

Respuesta :

Аноним Аноним

25-10-2016

5 times 2 and 4 times 2

Answer Link

25-10-2016

Kind of confused by your question but here are two multiplication problems 5x3=15. 9x9=81

Answer Link

Otras preguntas

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio

2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s

9. There are many more organisms that use double stranded DNA to carry their genetic information than there are organisms that use single stranded DNA to carry

what is The Original Price of an item if it is discounted 36% and the selling price is 32$

approximately how long does it take the moon to complete one orbit around earth

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

which simple machines is NOT a wedge?

Which verb form correctly completes the sentence? Is the verb singular or plural? The boy with the red shirt and blue jeans __________ been his friend since h

explain the conditions for cloud formation