kmgamble56 kmgamble56
  • 25-01-2021
  • English
contestada

He map shows Europe in 1871. According to the map, what was Italy’s status in 1871?

Respuesta :

Kalebromans1234 Kalebromans1234
  • 29-01-2021

Answer:

According to the map, what was Italy’s status in 1871, Italy was fully united.

Options:

Italy was partially united. (False!)

Italy was fully united. (True!)

Italy was partly under Austrian rule. (False!)

Italy was divided in nation-states. (False!)

Hope this helps, Thank you for posting your question on here at Brainly.

Explanation:

Answer Link

Otras preguntas

Describe your knowledge of EPIC
Find the x intercept of the line graphed by the equation 1/2x-7y=7
What was the name of the Chinese Dynasty that ended the period of disunion
Which statements accurately describes mass?
two rectangles are similar to each other the smaller rectangle has a length of 8 inches and a width of 5 inches if a larger rectangle has a length of 36 inches
Firewood is stacked in a pile. The bottom row has 20 logs, and the top row was 14 logs. Each row has one more log than the row above it. How many logs are in th
What kind of source is "Percentage of College Degrees Awarded to Women”? It is a primary source because it is a journal or diary. It is a secondary source beca
DNA tacaggtacccgaacccaattta
Which of the following definitions best describes biology? the study of life the study of the Earth the study of animals the study of biomes
I will Give Brainliest!!!! What is Diffusion?