carsonrcouch32 carsonrcouch32

27-02-2021
Mathematics

contestada

i need help finding the system of inequalities!

i need help finding the system of inequalities class=

Respuesta :

chhbhjcashVchija chhbhjcashVchija

27-02-2021

Answer:

35

Step-by-step explanation:

h

Answer Link

Otras preguntas

Write a paragraph using -Multicellular ,Unicellular ,Tissue ,Xylem ,Organ , System In a paragraph

2 C2H2(g)+5 O2(g) −→ 4 CO2(g)+2 H2O(g).How much CO2 is produced when 30000 gof C2H2 burns completely?Answer in units of g

Which word means feeling or showing no sympathy for others? A. slovenly B. callous C. indignant D. draggletailed

Which associations best describe the scatter plot? Strikeouts vs. Practice Time A 220 Select each correct answer. 200 180 Nonlinear association 160 140 Linear a

How did farmers’ and miners’ responses to the scarcity of cotton and iron ore affect industrialization? How do you think the people’s standards of living would

evaluate the extent to which the industrial revolution impacted society in the period 1750-1914

Please help!!! I’ve taken this test like 10 times and can’t pass it!

Solve the following: four and seven twelfths plus six and nine twelfths eleven and four twelfths ten and two twelfths two and two twelfths one and four twel

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

How many 1/8 are in to in 16?