riverayareli07 riverayareli07
  • 26-03-2021
  • Mathematics
contestada

What is the equation of a line perpendicular to the line y = -1/5 x + 3 and going
through the point (4,-1). Please write your answer in point slope form.

Respuesta :

Ifgwgdhahsh Ifgwgdhahsh
  • 27-03-2021
Playjsjsnsjsjjssjjsjs dbsbs s s s s s. S s s s s s s. S s s s s s
Answer Link

Otras preguntas

what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
What are the adaptive immune responses induced following acute and chronic infection with HIV?
A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea
Guys <br /> I want the word resolute and naturalization in a sentence separate
1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t
Who discovered polio vaccine
How do short-term goals differ from long-term goals?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
if an element has more than one ionic caves how was that piece of information represented in a chemical name?