njvzx6yh7p njvzx6yh7p
  • 21-04-2021
  • Mathematics
contestada

Pls help me :v
Mxjgzjgkxgkxmhykx

Pls help me v Mxjgzjgkxgkxmhykx class=

Respuesta :

simonedsouza10
simonedsouza10 simonedsouza10
  • 21-04-2021

Answer:

slope m = 1   y-intercept b = 3

Step-by-step explanation:

to double check you can do use the formula y=mx+b

-3*1= -3 +3= 0

so the coordinates would be (-3,0)

Answer Link

Otras preguntas

A group of friends is sharing 2 1/2 pounds of berries if 5 friends are sharing berries how many pounds of berries does each friend recieve ?
hello guys I really need help is anyone available please and ty
Question 5 (1 point) How many moles of oxygen gas is needed to produce 36 grams of water?
Scientists find the fossilized remains of a fish in the middle rock layers of a research site. They find the fossil of an insect in the lowest rock layers. What
Work out the percentage change when a price of £40 is increased to £70.
A function is- A. the consequence that an element of society produces for the maintenance of its social system. B. The negative consequence an element has for t
PLZZ ANSWER ASAP A larger number is double the sum of 3 and a smaller number. The larger number is 2 less than 3 times the smaller number. If y represents the
A coal-fired 500 MW Power Plant has an efficiency of 35%, burns coal with an energy content of 10,000 BTU/lb, with 60% carbon content, 1.5% sulfur content. The
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
-6/1 divided by -3/8​