anythingnamjoon anythingnamjoon

23-04-2021
History

contestada

Who was involved in the Kitchen Cabinet event?

Respuesta :

Kobinaamuesi Kobinaamuesi

23-04-2021

Answer:

Andrew Jackson Donelson

Answer Link

nealhakim8993 nealhakim8993

20-05-2021

Answer: Martin Van Buren, Francis Preston Blair, Amos Kendall, William B. Lewis, Andrew Jackson Donelson, John Overton, Isaac Hill, and Roger B. Taney.

Explanation:mark brainlist please

Answer Link

Otras preguntas

What's x² + 2x + 1 factorised?

7. Which of the following rivers is the world's busiest waterway? A. Rhone B. Rhine C. Danube D. Seine

Click ___ to move a stacked object to the top of the stack.

Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner

If 1+4=5; 2+5=12; 3+6==21; what is 8+11

What two countries on opposite sides of the ring of fire were shaken by major earthquakes last weekend

I need help with this quickly please

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

a brown dog is crossed with two different black dogs. The first cross produced only black dogs and the second cross produces equal numbers of black and brown do

what is the solution of the following question? x^2+10x+25=12