bassamamri360z
bassamamri360z bassamamri360z
  • 25-04-2021
  • Biology
contestada

Height in humans is an example of

Respuesta :

FeliciaMakofane
FeliciaMakofane FeliciaMakofane
  • 25-04-2021

Answer:

Polygenic inheritance

Explanation:

Polygenic inheritance refers to inheritance of a phenotypic characteristics (trait) that is attributable to two or more genes and can be measured quantitatively.

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
How are vibrations different between bigger sizes rubber bands and smaller sized rubber bands?
which of the following statements most accurately describes the effects caused by binding of the neurotransmitter (green dots) to the structure labeled C? a. Th
what would you call a object that makes people shut up
Factor 3s+27t. Please help me I was absent for about a week with a high fever when she taught this lesson. I'm on 73% on IXL so PLEASE HELP!
Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this
What is double consciousness
Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron
Could someone help with the questions in the images below? Some I have already completed - please let me know if they are right! and the others are blank.
how was sam houston passionate? give atleast 2 examples with explanation