crystal10023
crystal10023 crystal10023
  • 24-05-2021
  • Physics
contestada

what are two units we use for measuring force?​

Respuesta :

msm555
msm555 msm555
  • 24-05-2021

two units we use for measuring force

is I. newton[N] [S.I unit]

and

2.dyne[C.G.S. unit]

Answer Link
katenevarez11119 katenevarez11119
  • 24-05-2021

Answer:

Newton, and jules

Explanation:

ny teacher reviewed ir

Answer Link

Otras preguntas

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Question 2 A high-school teacher helps Yang to understand that her handwriting is difficult to read. O that she is a gifted writer. the importance of Romeo and
Write 3 sentences about a utopia that will be a progressed version of earth.
PLEASE ANSWER QUICK!!! 25POINTS + BRAINLIEST
4) What is a desktop?​
Which type of biological macromolecule contains carbon, hydrogen, oxygen, and sometimes phosphorus? A. Lipids B. Nucleic acid C. Carbohydrates D. Proteins
A particle is projected vertically upwards with a velocity U. After an interval of time t another particle is projected upwards from the same point and with the
Suppose that Motorola uses the normal distribution to determine the probability of defects and the number of defects in a particular production process. Assume
The Financial Management Instruction should be referenced:
1. Consider a first order dynamical system described by dy(t) + y(t) =u(t) (1) dt where u(t) is the input and y(t) is the output. Show that the relation between