mathew090070 mathew090070

26-05-2021
Mathematics

contestada

40 POINTS!!!!! Find the value of x in the triangle shown below.

40 POINTS Find the value of x in the triangle shown below class=

Respuesta :

runayom0zukki runayom0zukki

26-05-2021

Answer:

a

Step-by-step explanation:

Answer Link

Otras preguntas

What’s a country and it’s purpose?

Help help help math math

How many grams of iron are in 350 mg of iron? * O A. 3.50 g O B.0.350 g O C.35.09

A camper attaches a rope to the top of her tent to give it more support. She stakes the rope, which is 8 ft long, to the ground at a distance of 6 feet from the

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Throughout the essay, Alexander presents and then responds to the views of others. Find two examples where Alexander introduces the views of others. In each cas

why should the public have access to the technical records

HELP!!!! Which statement describes earthquakes? They release energy. They are caused by reduced stress in rocks. They begin at the epicenter. They result from

Kimi and Jordan are each working during the summer to earn money in addition to their weekly allowance, and they are saving all of their money. Kimi earns $9 pe

Alex has not been keeping his banking records up to date. On his latest bank statement, he found that he had been charged an overdraft fee for writing a bad che