aniyahprince06 aniyahprince06

21-06-2021
History

contestada

What did the Byzantine Empire struggle with just before the powerful rise of the Ottoman Empire?

Respuesta :

amberbrown2333 amberbrown2333

21-06-2021

Answer:

The byzantine empire struggled with low moral, corrupt leadership, bad politics, and excessive spending in the military

I hope that helps!

Answer Link

Otras preguntas

What was the primary reason for the English colonization of Jamestown in 1607 near the James river

The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both

which of the following statements about taxes is FALSE? A-Taxes are collected a the local, state and federal level. B-Some states don't collect income tax. C-So

7- What types of RNA are present in a cell and how can you selectively make copies of only the mRNAs?

what two Georgians signed the united states constitution

what is the solution of the following question? x^2+10x+25=12

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what are the chromosome numbers of daughter cells in mitosis and meiosis

What does the equation -355-n=-957 what does n equal?

why are cancer causing factors in lifestyle and environment difficult to identify