jazzy328crystal jazzy328crystal
  • 25-09-2021
  • Mathematics
contestada

what is the perimeter, in units of the parallelogram
a) 24
b) 36
c) 48
d) 64

what is the perimeter in units of the parallelogram a 24 b 36 c 48 d 64 class=

Respuesta :

melisozge250 melisozge250
  • 25-09-2021
The answer is B) 36 I think



Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
If a DNA template strand has a sequence of 3' TACAATGTAGCC 5', then the RNA produced from it will be which sequence? A.) 3' AUGUUACAUCGG 5'. B.) 3' TACAATGTAGCC
Does this represent a linear function?
why is marijuana the most widely used drug?
of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why
what procedure could you use to test the effect of a catalyst on a reaction
explain the conditions for cloud formation
How many cm has a inch
why are cancer causing factors in lifestyle and environment difficult to identify
Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e