Aaqib100iq
Aaqib100iq Aaqib100iq
  • 21-10-2021
  • Biology
contestada

Nitrogen is used for the synthesis of plant proteins and other compounds True / False

Respuesta :

Food1237 Food1237
  • 21-10-2021

Answer:

True

Explanation:

Its true because nitrogen is required for production of chlorophyll, nucleic acids, and enzymes. Nitrogen is essential for plants to synthesize amino acids, which are the building blocks for protein synthesis.

Answer Link

Otras preguntas

Who discovered polio vaccine
If 1+4=5 and 2+5=12 what does 8+11=
In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre
The answer to 5+5×5+5=
Please help me answer these questions
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Lee used her computer for 60 minutes on Friday. On Saturday, she used her computer for 150% of the number of minutes she used it on Friday. What was the number
why are cancer causing factors in lifestyle and environment difficult to identify
Guys <br /> I want the word resolute and naturalization in a sentence separate
a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number