flattykawa71 flattykawa71

22-10-2021
Mathematics

contestada

−2(x+1)=x−3x−2 No solution, one solution, or infinite solutions

Respuesta :

22-10-2021

Answer:

infinite solutions (All real numbers are solutions)

Step-by-step explanation:

−2 *(x + 1) = x −3x −2

-2x - 2 = -2x -2

Answer Link

Otras preguntas

elevated blood cell count can be a result of: A. bacterial infection B. viral infection C. parasitic infection D. immune hypersensitivity/ allergic reactions E.

What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air and sulfur mainly from the soil

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

write a sentence using the words limiting factor and carrying capacity

In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?

how are the four earths systems connected

What's 165% as a fraction and decimal

analyze how heat transfer occurs during the processes of conduction and convection.

find the quotient of 3870 and 18

During the 1800s, the nations supply of currency was tied to its national reserves of either gold or silver. In 1900, an act was passed by congress that would s