shaunae6679 shaunae6679

22-02-2022
Mathematics

contestada

Fatema sold liters of soda at a baseball game. How much is this in milliliters?

Respuesta :

irun504 irun504

22-02-2022

Answer: 1 liter is 1,000 milliliters

Step-by-step explanation:

It’s a conversion rule. Just plug in your liter value. Times your liter by 1000 and you will have your mililiter value.

Answer Link

Otras preguntas

who was the aztec leader in 1519 A) chief joseph B) sitting bull C) montezuma D) atahualpa

what is the cultural context of a piece of literature?

DNA tacaggtacccgaacccaattta

Read the excerpt from Amy Tan's essay "Mother Tongue." I know this for a fact, because when I was growing up, my mother's "limited" English limited my perceptio

How many solutions does this equation have? 6h-(9-3h)=6-3(h+2) A) 1 B) 0 C) infinitely many

The Mammoth Cave Discovery Tour includes an elevation change of 140 feet. This is 7/15 of the elevation change on the Wild Cave Tour? Use a equation to solve al

Which are characteristics of the yellow journalism? Check all that apply. •Sensational language •Well-supported, fact-based arguments •exaggeration •eye-catc

What is the equation of the line perpendicular to 2x + 5y =20 in containing the point (10, -4)

What did the homestead act do? Check all of the boxes that apply.

A museum has 75 carvings in its collection. It has 10 more pieces of pottery than carvings. It has 3 times as many paintings as pieces of pottery. How many pain