aymenfathima09 aymenfathima09
  • 23-02-2022
  • Mathematics
contestada

Please help me with this question

Please help me with this question class=

Respuesta :

joniwillgarcia
joniwillgarcia joniwillgarcia
  • 23-02-2022

Answer:

18

Step-by-step explanation:

House number:

1. has 3 people

2. has 2 people

3. has 3 people

4. has 2 people

5. has 3 people

6. has 2 people

7. has 3 people

looking at each rule, it all fits.

so now add it all up so its 18

Answer Link

Otras preguntas

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices
Click ___ to move a stacked object to the top of the stack.
what are the chromosome numbers of daughter cells in mitosis and meiosis
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how would living in Sparta or Athens be like
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Prolonged use of antipsychotics may lead to ______ in adults..... extrapyramidal effects and tardive dyskinesia parkinsonism-like symptoms neither a or b both a
Whose image will replace Andrew Jackson on the U.S. 20$ bill
Write a recursive function for this sequence 8,12,18,27..
A cargo plane flew to Moscow and back. It took six hours longer to go there than it did to come back. The average speed on the trip there was 152 mph. The avera