felslin
felslin felslin
  • 22-05-2017
  • Mathematics
contestada

Find the quotient of 4 1/4 divide 2 1/5

Respuesta :

chingho2021306
chingho2021306 chingho2021306
  • 22-05-2017
1 41/44

first change both into improper fractions
because it's division, flip the second term while changing sign from division to multiplication.
Answer Link

Otras preguntas

Which property does each equation demonstrate? (2x2 + 7x) + (2y2 + 6y) = (2y2 + 6y) + (2x2 + 7x)
You just borrowed money for four years to buy a car. The payments are $218 a month and the APR is 7 percent. How is the EAR computed?
What algebraic expression is equivalent to 8(2x+4) ? ​
Provide at least 3 reasons why ice cores can be useful as it relates to climate change and type of organisms living during that time.
the measures of the angles of a triangle are shown below. solve for x ​
Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands
Write as a product of prime factors each of the following numbers : 15,147 ; 36 x 210 ; 4203
How does the narrator feel about starting the final race? In Racing for Olympic Gold
Help me please I need help
Cellphone plan A costs $35 for having the phone plus $0.40 per text message. Cellphone plan B costs $45 for having the phone plus $0.30 per text message. How ma