msm22 msm22
  • 23-06-2017
  • Mathematics
contestada

Let f(x) = 4x + 3 and g(x) = -2x + 5. Find.(f o g) (5)

Respuesta :

3mar 3mar
  • 23-06-2017
f(x) = 4x + 3
g(x) = -2x + 5

(f o g) (5) means the function of g when g is a function of 5
(the function of the function concept)

so we need to get g(5) firstly


g(x) = -2x + 5
g(5)= -2(5) + 5 = -5

After that, f(g(5)) = f(-5) = 4(-5) + 3 = -20 + 3 = -17


I hope that helps
Answer Link

Otras preguntas

A portable cooler is 19 inches long, 14 inches wide, and 14 inches tall. A cooler that is shaped like a rectangular prism. Sanit Fuangnakhon/Shutterstock What i
If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc​
Stuff that's displayed on a web page (Has to be 7 characters) (third letter is N, and fifth letter is E) little urgent
I need help solving this square problem
was ist dein Lieblingsessen?
How do you know if you are eligible to open and make contributions to a Roth IRA? You have to have held your current job for at least 1 year. You have to earn b
What is the awnser to this problem 3x-8(x-8)=24
A 61 kg person is in a head-on collision. The car's speed at impact is 14 m/s. Estimate the net force on the person if he or she is wearing a seat belt and if t
Products that have very basic packaging with no brand name, are backed with little or no advertising, and typically have prices much lower than branded products
What subject do you guys like???? Just curious it’s for l00 points if you answer