SketchWasTaken SketchWasTaken

21-09-2017
Spanish

contestada

Which verb form best completes this conversation?

Luisa: ¿Qué comiste anoche?
Mario: ________ una pizza.

Comieron
Comió
Comí
Comiste

Respuesta :

valeryaponte20 valeryaponte20

21-09-2017

Mario: comí una pizza.

Answer Link

mcastorena17 mcastorena17

21-09-2017

Mario: Comi una pizza.

Answer Link

Otras preguntas

Dr. Potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination

What is 7 3/4 times 7?

As the Civil War drew to a conclusion, the chief concern of Republicans in Congress was that

A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ

Please answer and put how

Three differences and one similarity between Shakespeare world and our own

Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell

1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t

Question 16 of 20 Select the best answer for the question. 16. Which of these federal policing agencies is part of the U.S. Department of the Treasury?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC