belemmichell4p3uhsh belemmichell4p3uhsh
  • 26-03-2018
  • Social Studies
contestada

a republican form of government is understood to mean__?
1.) a military government
2.) a representative government
3.) a democratic government
4.) a popular government

Respuesta :

officialnalanip67jak
officialnalanip67jak officialnalanip67jak
  • 26-03-2018
2.) a representative government
Answer Link
Аноним Аноним
  • 19-09-2018

The correct answer is:  A Representative Government

Answer Link

Otras preguntas

IS PERRY ATTRACTIVe?!?!?!
Is y=1/5^x exponential growth or decay
The Western and Eastern Empires both fell to the Goths True or False
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Type your summary of Summer in New York City here. Use the summary you were prompted to write in the lesson and make any necessary improvements
what is amphotheric oxide give me an two instance​
karina says the change in the guppy population was caused by a mutation. miles says the change was caused by a change in the environment. zora thinks both karin
In steps 4 and 5, you are shown the offspring first. Here, you will use a Punnett square to determine actual results of a cross between offspring. the actual ag
SECTION(Financial literacy)Question 5 (Accounting equation)1. Goods bought by cheque from Makro wholesalers R 22 000​
Nicole runs 6 miles in 50 minutes. At the same rate, how many miles would she run in 35 minutes?