wrewgwee1725 wrewgwee1725

22-04-2018
Mathematics

contestada

Shun is going to flip a fair coin 450 times.Complete the following statement with the best prediction.The coin will land tails up...

Respuesta :

theyloveety theyloveety

22-04-2018

Its 50/50; It’s a 1/2 chance it’ll land heads up and 1/2 it’ll and heads down

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

WILL GIVE BRAINLIEST!!Which statement best explains the effectiveness of this introduction paragraph? Over 150 million people use the social media photo applica

Mr. Jay sells a box of 15 seedlings for new trees for $12.84. Mr. Tony sells a box of 18 seedlings for $14.95. What is the cost per seedling for each person? Ro

plss help me with this:(((

Which lines from "Dreams" by Langston Hughes contain a metaphor? A. frozen with snow B. Life is a barren field C. Hold fast to dreams

The preganglionic fibers of the sympathetic nervous division originate in segments ____ of the spinal cord and first enter the ____ ganglia.

What Is the answers?

The _______ conditional formatting option allows you to define formatting for cells that meet specific numerical or text criteria (greater than, or containing a

last week, dave predicted his weight at his physical would be 164 lbs. At the doctor’s his actual weight was 175 lbs. what was the percent of error in Dave’s es

I REALLY NEED HELP PLEASE!!! ILL GIVE BRAINIEST!!! IT ENDS TOMORROW I NEED HELP Kiley and her parents traveled to visit her grandmother. They drove 24.3 miles f