morrae04 morrae04
  • 24-06-2021
  • English
contestada

Diaries, letters, and journals are _____.

Respuesta :

kingt16 kingt16
  • 24-06-2021

Answer:

primary source documents

Explanation:

Answer Link

Otras preguntas

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
for which functions f ' (x) is equal to f^-1 (x)
What are some fun facts about bacteria reproduction?
Which sentence option correctly uses a colon? A. This is how I plan to start my book report "If you want to chuckle and cheer: then cry and fear, my book is for
This is another question thats for my Evolution pt 2 test!! Please help if you know the answers ( I’ll make u brainliest if you answer 1. “Making comparisons:
1. Solve for x X - 10 = 15
Match the definition to the answer no need to show ure work plz answer the question I need help plz I’ll do anything
The two-way frequency table below shows data on a student's performance on a math test and that student's gender for students in Ms. Matchenbacker's class. Comp
Emma will roll 2 number cubes labelled 1 through 6. She will record the sum of the two numbers after each roll. She will roll the 2 cubes 540 times. How many ti
1. The Himalaya Mountains run through most of ______.