kimvilla4life kimvilla4life

25-09-2021
Mathematics

contestada

eill mark brainliest lol

eill mark brainliest lol class=

Respuesta :

Mykie2020 Mykie2020

25-09-2021

Answer:

Supplementary/Linear (x=16)

Step-by-step explanation:

16*7= 112

112-13= 99

16*5=80

80+1=81

99+81=180

Hope this helps! :)

Answer Link

Otras preguntas

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

When you come to a corner where there is a flashing yellow light, you must? 1) Stop before crossing 2) Wait for the green light 3) Slow down and cross carefully

erpt from Act III of Hamlet. ce does make cowards of us all; ative hue of resolution with the pale cast of thought, s of great pith and moment their currents tu

NO LINKS!! URGENT HELP PLEASE!!! Follow the directions carefully. Graph the following function by first graphing the base graph and then each transformation. L

Check for extraneous solutions: (2x+6)/(x²-x) = 6/(x-1) + (x-4)/x

what were the experiences of minority soldiers during wwll. Why were they willing to participate in the war effort?

Ano Ang La Ilustrasyon o Age of Enlightenment

You are the health director for a small rural town in Illinois. The area has an influx of individuals from special populations (e.g., homeless, disabled, elderl

what are the way of communicating about a product or a service to a target audience?

Question 2 (0.5 points) Match the types of mutation with their definition the addition of a nucleotide changing the reading frame. 1. Substitution (point): the