Kittyhacker14
Kittyhacker14 Kittyhacker14
  • 25-10-2021
  • Mathematics
contestada

Consider the following right triangle. Which equation below can be used to solve for the unknown side length?

Consider the following right triangle Which equation below can be used to solve for the unknown side length class=

Respuesta :

jimthompson5910 jimthompson5910
  • 25-10-2021

Answer: Choice B)  [tex]36 + x^2 = 64[/tex]

Explanation:

We use the pythagorean theorem with the following values

  • a = 6
  • b = x
  • c = 8

So,

[tex]a^2 + b^2 = c^2\\\\6^2 + x^2 = 8^2\\\\36 + x^2 = 64\\\\[/tex]

Answer Link

Otras preguntas

can someone please help me answer these?
Energy consumption contributes directly to which of the following environmental problems?
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
The diagram below is an artist’s impression of a single atom of element Be. The neutrons are shown with stripes, the protons are gray, and the electrons are bla
Guillermo Lujan is flying from Denver to Dallas for a convention. He can park his car in the Denver airport long-term parking lot at the terminal or in the shut
1 point Find mzJKL. (3x + 15) (2x + 10)° J K M
why does patrick henry say give me the liberty of death
PLEASE HELP I WILL GIVE 80 POINTS!!!!!!!Solve each equation on your own, and stating the properties of equality you used; check your work by using substitution.
10. The boys and girls in Mrs. Hall's class are collecting cans for the food drive. The ratio of cans saved by the boys versus the girls is 2:5. The girls have
PLEASE HELP Read the second stanza from the poem "Sympathy." I know why the caged bird beats his wing Till its blood is red on the cruel bars; For he must fly b